The hardware and bandwidth for this mirror is donated by dogado GmbH, the Webhosting and Full Service-Cloud Provider. Check out our Wordpress Tutorial.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]dogado.de.

traits introduction

Scott Chamberlain

2020-08-25

library("traits")

BetyDB

Get trait data for Willow (Salix spp.)

(salix <- betydb_search("Salix Vcmax"))
#> # A tibble: 14 x 36
#>    checked result_type    id citation_id site_id treatment_id sitename city 
#>      <int> <chr>       <int>       <int>   <int>        <int> <chr>    <chr>
#>  1       1 traits      39217         430     645         1342 ""       Saare
#>  2       1 traits      39218         430     645         1343 ""       Saare
#>  3       1 traits      39219         430     645         1344 ""       Saare
#>  4       1 traits      39220         430     645         1345 ""       Saare
#>  5       1 traits      25405          51      NA            1  <NA>    <NA> 
#>  6       1 traits      39213         430     645         1342 ""       Saare
#>  7       1 traits      39214         430     645         1343 ""       Saare
#>  8       1 traits      39215         430     645         1344 ""       Saare
#>  9       1 traits      39216         430     645         1345 ""       Saare
#> 10       1 traits      39221         430     645         1342 ""       Saare
#> 11       1 traits      39222         430     645         1343 ""       Saare
#> 12       1 traits      39223         430     645         1344 ""       Saare
#> 13       1 traits      39224         430     645         1345 ""       Saare
#> 14       1 traits      37519         381     602         1220  <NA>    <NA> 
#> # … with 28 more variables: lat <dbl>, lon <dbl>, scientificname <chr>,
#> #   commonname <chr>, genus <chr>, species_id <int>, cultivar_id <int>,
#> #   author <chr>, citation_year <int>, treatment <chr>, date <chr>, time <chr>,
#> #   raw_date <chr>, month <int>, year <int>, dateloc <chr>, trait <chr>,
#> #   trait_description <chr>, mean <dbl>, units <chr>, n <int>, statname <chr>,
#> #   stat <dbl>, notes <chr>, access_level <int>, cultivar <chr>, entity <lgl>,
#> #   method_name <lgl>
# equivalent:
# (out <- betydb_search("willow"))

Summarise data from the output data.frame

library("dplyr")
salix %>%
  group_by(scientificname, trait) %>%
  mutate(.mean = as.numeric(mean)) %>%
  summarise(mean = round(mean(.mean, na.rm = TRUE), 2),
            min = round(min(.mean, na.rm = TRUE), 2),
            max = round(max(.mean, na.rm = TRUE), 2),
            n = length(n))
#> # A tibble: 4 x 6
#> # Groups:   scientificname [4]
#>   scientificname                  trait  mean   min   max     n
#>   <chr>                           <chr> <dbl> <dbl> <dbl> <int>
#> 1 Salix                           Vcmax  65    65    65       1
#> 2 Salix dasyclados                Vcmax  46.1  34.3  56.7     4
#> 3 Salix sachalinensis × miyabeana Vcmax  79.3  79.3  79.3     1
#> 4 Salix viminalis                 Vcmax  43.0  20.0  61.3     8

NCBI sequence data

Get sequences by id

ncbi_byid(ids = "360040093")
#>                  taxon
#> 1 Eristalis transversa
#>                                                                                                                                                                                       taxonomy
#> 1 Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Holometabola; Diptera; Brachycera; Muscomorpha; Syrphoidea; Syrphidae; Eristalinae; Eristalini; Eristalis
#>                                                                                                             gene_desc
#> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#>       organelle     gi_no     acc_no keyword   specimen_voucher
#> 1 mitochondrion 360040093 JN991986.1 BARCODE CNC:Diptera:102013
#>               lat_lon
#> 1 38.4623 N 79.2417 W
#>                                                       country
#> 1 USA: Virginia, Reddish Knob Lookout, 14.5km W Briery Branch
#>                                                              paper_title
#> 1 The evolution of imperfect mimicry in hover flies (Diptera: Syrphidae)
#>       journal first_author uploaded_date length
#> 1 Unpublished   Penny,H.D.   03-NOV-2012    658
#>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             sequence
#> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc

Get sequences searching by taxonomic name

out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000")
#> using sleep: 0
#> ══  1 queries  ═══════════════
#> ✔  Found:  Umbra+limi
#> ══  Results  ═════════════════
#> 
#> ● Total: 1 
#> ● Found: 1 
#> ● Not Found: 0
head(out)
#>        taxon length
#> 1 Umbra limi    298
#> 2 Umbra limi    761
#> 3 Umbra limi    765
#> 4 Umbra limi    764
#> 5 Umbra limi    743
#> 6 Umbra limi    758
#>                                                                                                gene_desc
#> 1 Umbra limi voucher Umbra_limi_GLF16S large subunit ribosomal RNA gene, partial sequence; mitochondrial
#> 2                                        Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds
#> 3                                         Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds
#> 4                                        Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds
#> 5                                         Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds
#> 6                                        Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds
#>     acc_no      gi_no
#> 1 MT549086 1847697133
#> 2 KX146134 1049488959
#> 3 KX146015 1049488721
#> 4 KX145969 1049488629
#> 5 KX145777 1049488245
#> 6 KX145759 1049488209

EOL’s traitbank trait data

traitbank(query = "MATCH (n:Trait) RETURN n LIMIT 1;")
#> $columns
#> [1] "n"
#> 
#> $data
#> $data[[1]]
#>   metadata.id metadata.labels    data.eol_pk data.object_page_id
#> 1    22529388           Trait R20-PK20910350            46581789
#>                                                    data.resource_pk
#> 1 ReverseOf_globi:assoc:7296029-FBC:FB:SpecCode:4755-ATE-EOL_V2:281
#>   data.scientific_name
#> 1              Plantae
#>                                                                                                                                                                                                                                                             data.source
#> 1 Froese, R. and D. Pauly. Editors. 2019. FishBase. World Wide Web electronic publication. www.fishbase.org, version (08/2019). Accessed at <https://github.com/globalbioticinteractions/fishbase/archive/6ebceaacea18c6ff6c247182f9af8ad6fc05cc82.zip> on 25 May 2020.

Birdlife International

Habitat data

birdlife_habitat(22721692)
#>         id Habitat (level 1)                  Habitat (level 2) Importance
#> 1 22721692            Forest           Subtropical/Tropical Dry      major
#> 2 22721692            Forest Subtropical/Tropical Moist Montane      major
#> 3 22721692            Forest                          Temperate   suitable
#> 4 22721692         Shrubland Subtropical/Tropical High Altitude   suitable
#>     Occurrence
#> 1     breeding
#> 2 non-breeding
#> 3     breeding
#> 4     breeding

Threats data

birdlife_threats(22721692)
#>          id                                                  threat1
#> 1  22721692                                Agriculture & aquaculture
#> 2  22721692                                Agriculture & aquaculture
#> 3  22721692                                  Biological resource use
#> 4  22721692                          Climate change & severe weather
#> 5  22721692                          Climate change & severe weather
#> 6  22721692                          Climate change & severe weather
#> 7  22721692 Invasive and other problematic species, genes & diseases
#> 8  22721692 Invasive and other problematic species, genes & diseases
#> 9  22721692 Invasive and other problematic species, genes & diseases
#> 10 22721692 Invasive and other problematic species, genes & diseases
#> 11 22721692 Invasive and other problematic species, genes & diseases
#> 12 22721692 Invasive and other problematic species, genes & diseases
#> 13 22721692                             Natural system modifications
#> 14 22721692                             Natural system modifications
#> 15 22721692                     Residential & commercial development
#> 16 22721692                       Transportation & service corridors
#>                                                                                   threat2
#> 1                             Annual & perennial non-timber crops - Agro-industry farming
#> 2                              Annual & perennial non-timber crops - Small-holder farming
#> 3  Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest]
#> 4                                                                                Droughts
#> 5                                                           Habitat shifting & alteration
#> 6                                                                       Storms & flooding
#> 7                                 Invasive non-native/alien species/diseases - Sus scrofa
#> 8                        Invasive non-native/alien species/diseases - Unspecified species
#> 9                            Problematic native species/diseases - Dendroctonus frontalis
#> 10                           Problematic native species/diseases - Odocoileus virginianus
#> 11                              Problematic native species/diseases - Unspecified species
#> 12                    Problematic species/disease of unknown origin - Unspecified species
#> 13                                     Fire & fire suppression - Trend Unknown/Unrecorded
#> 14                                                          Other ecosystem modifications
#> 15                                                                  Housing & urban areas
#> 16                                                                      Roads & railroads
#>                                                                 stresses
#> 1                     Ecosystem degradation, Ecosystem conversion, Other
#> 2                     Ecosystem degradation, Ecosystem conversion, Other
#> 3                                                  Ecosystem degradation
#> 4                                                  Ecosystem degradation
#> 5                            Ecosystem degradation, Ecosystem conversion
#> 6                                                  Ecosystem degradation
#> 7                            Ecosystem degradation, Ecosystem conversion
#> 8                                                      Species mortality
#> 9                                                  Ecosystem degradation
#> 10                                                 Ecosystem degradation
#> 11                   Ecosystem degradation, Reduced reproductive success
#> 12                                                     Species mortality
#> 13                           Ecosystem degradation, Ecosystem conversion
#> 14                           Ecosystem degradation, Ecosystem conversion
#> 15 Ecosystem degradation, Ecosystem conversion, Species mortality, Other
#> 16                                                     Species mortality
#>                                                      timing
#> 1                                 Agriculture & aquaculture
#> 2                                 Agriculture & aquaculture
#> 3                                   Biological resource use
#> 4                           Climate change & severe weather
#> 5                           Climate change & severe weather
#> 6                           Climate change & severe weather
#> 7  Invasive and other problematic species, genes & diseases
#> 8  Invasive and other problematic species, genes & diseases
#> 9  Invasive and other problematic species, genes & diseases
#> 10 Invasive and other problematic species, genes & diseases
#> 11 Invasive and other problematic species, genes & diseases
#> 12 Invasive and other problematic species, genes & diseases
#> 13                             Natural system modifications
#> 14                             Natural system modifications
#> 15                     Residential & commercial development
#> 16                       Transportation & service corridors
#>                                                                                     scope
#> 1                             Annual & perennial non-timber crops - Agro-industry farming
#> 2                              Annual & perennial non-timber crops - Small-holder farming
#> 3  Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest]
#> 4                                                                                Droughts
#> 5                                                           Habitat shifting & alteration
#> 6                                                                       Storms & flooding
#> 7                                 Invasive non-native/alien species/diseases - Sus scrofa
#> 8                        Invasive non-native/alien species/diseases - Unspecified species
#> 9                            Problematic native species/diseases - Dendroctonus frontalis
#> 10                           Problematic native species/diseases - Odocoileus virginianus
#> 11                              Problematic native species/diseases - Unspecified species
#> 12                    Problematic species/disease of unknown origin - Unspecified species
#> 13                                     Fire & fire suppression - Trend Unknown/Unrecorded
#> 14                                                          Other ecosystem modifications
#> 15                                                                  Housing & urban areas
#> 16                                                                      Roads & railroads
#>    severity  impact
#> 1   Ongoing Ongoing
#> 2   Ongoing Ongoing
#> 3   Ongoing Ongoing
#> 4   Ongoing Ongoing
#> 5    Future  Future
#> 6   Ongoing Ongoing
#> 7   Ongoing Ongoing
#> 8   Ongoing Ongoing
#> 9   Ongoing Ongoing
#> 10  Ongoing Ongoing
#> 11  Ongoing Ongoing
#> 12  Ongoing Ongoing
#> 13  Ongoing Ongoing
#> 14   Future  Future
#> 15  Ongoing Ongoing
#> 16  Ongoing Ongoing

These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.
Health stats visible at Monitor.