De novo Chimera Detection

Overview

The rchime() function allows you to detect and remove chimeric sequences using the dataset as it’s own reference (de novo). The denovo approach is our preferred method for removing chimeras. rchime() can be used with strollur objects or data.frames as inputs. Let’s look at examples of both data types using sequence data from mothur’s MiSeq_SOP example analysis.

Creating strollur objects

fasta_data <- readRDS(rchime_example("miseq_fasta.rds"))
abundance_data <- readRDS(rchime_example("miseq_abundance.rds"))

strollur <- strollur::new_dataset("rchime de novo example")

strollur::add(strollur, table = fasta_data, type = "sequence")
#> Added 6084 sequences.
strollur::assign(strollur, table = abundance_data, type = "sequence_abundance")
#> Assigned 6084 sequence abundances.

strollur
#> rchime de novo example:
#> 
#>             starts ends nbases ambigs polymers numns   numseqs
#> Minimum:         1  249    249      0        3     0      1.00
#> 2.5%-tile:       1  252    252      0        4     0   3216.38
#> 25%-tile:        1  252    252      0        4     0  32163.75
#> Median:          1  253    253      0        4     0  64327.50
#> 75%-tile:        1  253    253      0        5     0  96491.25
#> 97.5%-tile:      1  254    254      0        6     0 125438.62
#> Maximum:         1  256    256      0        8     0 128655.00
#> Mean:            1  252    252      0        4     0  64327.64
#> 
#> Number of unique seqs: 6084 
#> Total number of seqs: 128655 
#> 
#> Total number of samples: 20

Loading data.frames

df <- readRDS(rchime_example("miseq_data_frame_by_sample.rds"))

str(df)
#> 'data.frame':    11039 obs. of  4 variables:
#>  $ sequence_name: chr  "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" ...
#>  $ sequence     : chr  "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ ...
#>  $ sample       : chr  "F3D2" "F3D146" "F3D149" "F3D150" ...
#>  $ abundance    : int  222 1 1 1 127 17 32 13 95 86 ...

Removing chimeras

When removing chimeras using the de novo method, the potential parents are chosen from more abundant sequences in your dataset.

Before we remove the chimeras let’s discuss the dereplicate parameter. When dereplicate=FALSE, if a sequence is flagged as chimeric in one sample, it is removed from all samples. Our experience suggests that this is a bit aggressive since we’ve seen rare sequences get flagged as chimeric when they’re the most abundant sequence in another sample. For a more conservative approach, we recommend using the default dereplicate=TRUE which will only remove sequences from the samples in which they are flagged as chimeric. Let’s use the de novo method to remove the chimeras.

strollur_results <- rchime(strollur)
#> ℹ The de novo method runs with a single processor.
#> Added a chimera_report report.
#> → rchime removed `10453` chimeras from your dataset.
#> → It took `4.47755408287048` seconds to detect and remove the chimeras.

strollur
#> rchime de novo example:
#> 
#>             starts ends nbases ambigs polymers numns   numseqs
#> Minimum:         1  249    249      0        3     0      1.00
#> 2.5%-tile:       1  252    252      0        4     0   2955.05
#> 25%-tile:        1  252    252      0        4     0  29550.50
#> Median:          1  253    253      0        4     0  59101.00
#> 75%-tile:        1  253    253      0        5     0  88651.50
#> 97.5%-tile:      1  254    254      0        6     0 115246.95
#> Maximum:         1  256    256      0        8     0 118202.00
#> Mean:            1  252    252      0        4     0  59101.14
#> 
#> scrap_summary:
#>       type      trash_code unique total
#> 1 sequence rchime-chimeras   3588 10453
#> 
#> Number of unique seqs: 2496 
#> Total number of seqs: 118202 
#> 
#> Total number of samples: 20 
#> Total number of custom reports: 1

data_frame_results <- rchime(df)
#> ℹ The de novo method runs with a single processor.
#> → rchime detected `10453` chimeras in your dataset.
#> → It took `4.48363208770752` seconds to detect the chimeras.

Results

The rchime() function returns a list containing the results of the function. When you are running the command with a strollur object, the chimera_report is added, and chimeras are removed for you automatically. Let’s take a closer look at the results returned.

Chimera Report

The chimera_report is a data.frame with a row for each sequence in your dataset. Let’s take a look at the first 5 chimeric sequences in the report:

strollur_results$chimera_report[
  strollur_results$chimera_report$Chimeric_Status == "Y",
] |> head(n = 5)
#>        Score                                        Query
#> 66 0.3805621 M00967_43_000000000-A3JHG_1_1106_11629_14238
#> 70 0.5261480 M00967_43_000000000-A3JHG_1_1103_26580_14708
#> 80 0.5580357 M00967_43_000000000-A3JHG_1_2101_21700_24164
#> 89 0.3348214 M00967_43_000000000-A3JHG_1_1112_23980_19089
#> 91 0.6377551 M00967_43_000000000-A3JHG_1_2110_20944_24019
#>                                         ParentA
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416
#>                                         ParentB
#> 66 M00967_43_000000000-A3JHG_1_2101_22400_13416
#> 70 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 80 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 89 M00967_43_000000000-A3JHG_1_1109_25348_18015
#> 91  M00967_43_000000000-A3JHG_1_1112_6862_18037
#>                                      Top_Parent        QM       QA       QB
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592  99.60317 98.01587 94.44444
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229 100.00000 97.61905 95.63492
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024 100.00000 98.01587 94.44444
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592 100.00000 98.80952 94.44444
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416 100.00000 98.01587 93.65079
#>         QAB       QT LY LN LA RY RN RA      Div Chimeric_Status
#> 66 93.25397 98.01587 13  0  0  4  0  1 1.587302               Y
#> 70 93.25397 97.61905 11  0  0  6  0  0 2.380952               Y
#> 80 92.46032 98.01587 14  0  0  5  0  0 1.984127               Y
#> 89 93.25397 98.80952 14  0  0  3  0  0 1.190476               Y
#> 91 91.66667 98.01587 16  0  0  5  0  0 1.984127               Y

Chimeras

Results also contains a list of the names of the chimeric sequences. Let’s get the names of the first 10 chimeras.

strollur_results$chimeras |> head(n = 10)
#>  [1] "M00967_43_000000000-A3JHG_1_1106_11629_14238"
#>  [2] "M00967_43_000000000-A3JHG_1_1103_26580_14708"
#>  [3] "M00967_43_000000000-A3JHG_1_2101_21700_24164"
#>  [4] "M00967_43_000000000-A3JHG_1_1112_23980_19089"
#>  [5] "M00967_43_000000000-A3JHG_1_2110_20944_24019"
#>  [6] "M00967_43_000000000-A3JHG_1_2107_23359_13368"
#>  [7] "M00967_43_000000000-A3JHG_1_1101_15516_19920"
#>  [8] "M00967_43_000000000-A3JHG_1_1103_19656_27166"
#>  [9] "M00967_43_000000000-A3JHG_1_1112_15051_19857"
#> [10] "M00967_43_000000000-A3JHG_1_2108_16511_16075"

Set_abundance_values

Results will only contain the set_abundance_values list when dereplicate = TRUE and you are NOT removing the chimeras automatically. set_abundance_values has three items: ‘sequence_names’, ‘abundances’ and ‘samples’. For each sequence in your dataset there will be an entry in sequence_names and abundances. The abundance values are parsed by sample, and the order is given in set_abundance_values$samples. Let’s look at the first two sequences abundances after detecting the chimeras:

names(data_frame_results$set_abundance_values)
#> [1] "sequence_name" "abundance"     "samples"

data_frame_results$set_abundance_values$samples
#>  [1] "F3D0"   "F3D1"   "F3D141" "F3D142" "F3D143" "F3D144" "F3D145" "F3D146"
#>  [9] "F3D147" "F3D148" "F3D149" "F3D150" "F3D2"   "F3D3"   "F3D5"   "F3D6"  
#> [17] "F3D7"   "F3D8"   "F3D9"   "Mock"

sequences_names <- c(
  "M00967_43_000000000-A3JHG_1_1103_5171_14027",
  "M00967_43_000000000-A3JHG_1_1101_10133_8460"
)

df[df$sequence_name %in% sequences_names, c(1, 3, 4)]
#>                                    sequence_name sample abundance
#> 1    M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D2       222
#> 2    M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D146         1
#> 3    M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D149         1
#> 4    M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D150         1
#> 5    M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D1       127
#> 6    M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D7        17
#> 7    M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D0        32
#> 8    M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D5        13
#> 9    M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D8        95
#> 10   M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D9        86
#> 11   M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D3         5
#> 12   M00967_43_000000000-A3JHG_1_1101_10133_8460   F3D6        20
#> 1092 M00967_43_000000000-A3JHG_1_1103_5171_14027   F3D0         5
#> 1093 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D148         1
#> 1094 M00967_43_000000000-A3JHG_1_1103_5171_14027   F3D2         4
#> 1095 M00967_43_000000000-A3JHG_1_1103_5171_14027   F3D1         6
#> 1096 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D142         1

data_frame_results$set_abundance_values$sequence_name[1:2]
#> [1] "M00967_43_000000000-A3JHG_1_1101_10133_8460" 
#> [2] "M00967_43_000000000-A3JHG_1_1101_10134_24617"

data_frame_results$set_abundance_values$abundance[1:2]
#> [[1]]
#>  [1]  32 127   0   0   0   0   0   1   0   0   1   1 222   5  13  20  17  95  86
#> [20]   0
#> 
#> [[2]]
#>  [1] 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

We can see that the abundances for sequence M00967_43_000000000-A3JHG_1_1101_10133_8460 remain the same meaning it was not chimeric in any sample it was present in. We can see that sequence M00967_43_000000000-A3JHG_1_1101_10134_24617 was found to be chimeric in every sample it was included in.

Now let’s look at an example of a sequence that was found to be chimeric in some of the samples it is present in.

df[
  df$sequence_name %in% "M00967_43_000000000-A3JHG_1_1103_5171_14027",
  c(1, 3, 4)
]
#>                                    sequence_name sample abundance
#> 1092 M00967_43_000000000-A3JHG_1_1103_5171_14027   F3D0         5
#> 1093 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D148         1
#> 1094 M00967_43_000000000-A3JHG_1_1103_5171_14027   F3D2         4
#> 1095 M00967_43_000000000-A3JHG_1_1103_5171_14027   F3D1         6
#> 1096 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D142         1

data_frame_results$set_abundance_values$samples
#>  [1] "F3D0"   "F3D1"   "F3D141" "F3D142" "F3D143" "F3D144" "F3D145" "F3D146"
#>  [9] "F3D147" "F3D148" "F3D149" "F3D150" "F3D2"   "F3D3"   "F3D5"   "F3D6"  
#> [17] "F3D7"   "F3D8"   "F3D9"   "Mock"

data_frame_results$set_abundance_values$abundance[
  data_frame_results$set_abundance_values$sequence_name %in%
    "M00967_43_000000000-A3JHG_1_1103_5171_14027"
]
#> [[1]]
#>  [1] 5 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

We can see that samples F3D0 and F3D142 did not find the sequence to be chimeric, but F3D1, F3D2, F3D148 did find it to be chimeric so the abundance for those samples is set to 0.