The rchime() function allows you to detect and remove
chimeric sequences using the dataset as it’s own reference (de novo).
The denovo approach is our preferred method for removing chimeras.
rchime() can be used with strollur
objects or data.frames as inputs. Let’s look at examples of both
data types using sequence data from mothur’s MiSeq_SOP example
analysis.
fasta_data <- readRDS(rchime_example("miseq_fasta.rds"))
abundance_data <- readRDS(rchime_example("miseq_abundance.rds"))
strollur <- strollur::new_dataset("rchime de novo example")
strollur::add(strollur, table = fasta_data, type = "sequence")
#> Added 6084 sequences.
strollur::assign(strollur, table = abundance_data, type = "sequence_abundance")
#> Assigned 6084 sequence abundances.
strollur
#> rchime de novo example:
#>
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 3216.38
#> 25%-tile: 1 252 252 0 4 0 32163.75
#> Median: 1 253 253 0 4 0 64327.50
#> 75%-tile: 1 253 253 0 5 0 96491.25
#> 97.5%-tile: 1 254 254 0 6 0 125438.62
#> Maximum: 1 256 256 0 8 0 128655.00
#> Mean: 1 252 252 0 4 0 64327.64
#>
#> Number of unique seqs: 6084
#> Total number of seqs: 128655
#>
#> Total number of samples: 20df <- readRDS(rchime_example("miseq_data_frame_by_sample.rds"))
str(df)
#> 'data.frame': 11039 obs. of 4 variables:
#> $ sequence_name: chr "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" ...
#> $ sequence : chr "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ ...
#> $ sample : chr "F3D2" "F3D146" "F3D149" "F3D150" ...
#> $ abundance : int 222 1 1 1 127 17 32 13 95 86 ...When removing chimeras using the de novo method, the potential parents are chosen from more abundant sequences in your dataset.
Before we remove the chimeras let’s discuss the
dereplicate parameter. When dereplicate=FALSE,
if a sequence is flagged as chimeric in one sample, it is removed from
all samples. Our experience suggests that this is a bit aggressive since
we’ve seen rare sequences get flagged as chimeric when they’re the most
abundant sequence in another sample. For a more conservative approach,
we recommend using the default dereplicate=TRUE which will
only remove sequences from the samples in which they are flagged as
chimeric. Let’s use the de novo method to remove the chimeras.
strollur_results <- rchime(strollur)
#> ℹ The de novo method runs with a single processor.
#> Added a chimera_report report.
#> → rchime removed `10453` chimeras from your dataset.
#> → It took `4.47755408287048` seconds to detect and remove the chimeras.
strollur
#> rchime de novo example:
#>
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 2955.05
#> 25%-tile: 1 252 252 0 4 0 29550.50
#> Median: 1 253 253 0 4 0 59101.00
#> 75%-tile: 1 253 253 0 5 0 88651.50
#> 97.5%-tile: 1 254 254 0 6 0 115246.95
#> Maximum: 1 256 256 0 8 0 118202.00
#> Mean: 1 252 252 0 4 0 59101.14
#>
#> scrap_summary:
#> type trash_code unique total
#> 1 sequence rchime-chimeras 3588 10453
#>
#> Number of unique seqs: 2496
#> Total number of seqs: 118202
#>
#> Total number of samples: 20
#> Total number of custom reports: 1
data_frame_results <- rchime(df)
#> ℹ The de novo method runs with a single processor.
#> → rchime detected `10453` chimeras in your dataset.
#> → It took `4.48363208770752` seconds to detect the chimeras.The rchime() function returns a list containing the
results of the function. When you are running the command with a
strollur object, the chimera_report is added, and chimeras are removed
for you automatically. Let’s take a closer look at the results
returned.
The chimera_report is a data.frame with a row for each sequence in your dataset. Let’s take a look at the first 5 chimeric sequences in the report:
strollur_results$chimera_report[
strollur_results$chimera_report$Chimeric_Status == "Y",
] |> head(n = 5)
#> Score Query
#> 66 0.3805621 M00967_43_000000000-A3JHG_1_1106_11629_14238
#> 70 0.5261480 M00967_43_000000000-A3JHG_1_1103_26580_14708
#> 80 0.5580357 M00967_43_000000000-A3JHG_1_2101_21700_24164
#> 89 0.3348214 M00967_43_000000000-A3JHG_1_1112_23980_19089
#> 91 0.6377551 M00967_43_000000000-A3JHG_1_2110_20944_24019
#> ParentA
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416
#> ParentB
#> 66 M00967_43_000000000-A3JHG_1_2101_22400_13416
#> 70 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 80 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 89 M00967_43_000000000-A3JHG_1_1109_25348_18015
#> 91 M00967_43_000000000-A3JHG_1_1112_6862_18037
#> Top_Parent QM QA QB
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592 99.60317 98.01587 94.44444
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229 100.00000 97.61905 95.63492
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024 100.00000 98.01587 94.44444
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592 100.00000 98.80952 94.44444
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416 100.00000 98.01587 93.65079
#> QAB QT LY LN LA RY RN RA Div Chimeric_Status
#> 66 93.25397 98.01587 13 0 0 4 0 1 1.587302 Y
#> 70 93.25397 97.61905 11 0 0 6 0 0 2.380952 Y
#> 80 92.46032 98.01587 14 0 0 5 0 0 1.984127 Y
#> 89 93.25397 98.80952 14 0 0 3 0 0 1.190476 Y
#> 91 91.66667 98.01587 16 0 0 5 0 0 1.984127 YResults also contains a list of the names of the chimeric sequences. Let’s get the names of the first 10 chimeras.
strollur_results$chimeras |> head(n = 10)
#> [1] "M00967_43_000000000-A3JHG_1_1106_11629_14238"
#> [2] "M00967_43_000000000-A3JHG_1_1103_26580_14708"
#> [3] "M00967_43_000000000-A3JHG_1_2101_21700_24164"
#> [4] "M00967_43_000000000-A3JHG_1_1112_23980_19089"
#> [5] "M00967_43_000000000-A3JHG_1_2110_20944_24019"
#> [6] "M00967_43_000000000-A3JHG_1_2107_23359_13368"
#> [7] "M00967_43_000000000-A3JHG_1_1101_15516_19920"
#> [8] "M00967_43_000000000-A3JHG_1_1103_19656_27166"
#> [9] "M00967_43_000000000-A3JHG_1_1112_15051_19857"
#> [10] "M00967_43_000000000-A3JHG_1_2108_16511_16075"Results will only contain the set_abundance_values list when dereplicate = TRUE and you are NOT removing the chimeras automatically. set_abundance_values has three items: ‘sequence_names’, ‘abundances’ and ‘samples’. For each sequence in your dataset there will be an entry in sequence_names and abundances. The abundance values are parsed by sample, and the order is given in set_abundance_values$samples. Let’s look at the first two sequences abundances after detecting the chimeras:
names(data_frame_results$set_abundance_values)
#> [1] "sequence_name" "abundance" "samples"
data_frame_results$set_abundance_values$samples
#> [1] "F3D0" "F3D1" "F3D141" "F3D142" "F3D143" "F3D144" "F3D145" "F3D146"
#> [9] "F3D147" "F3D148" "F3D149" "F3D150" "F3D2" "F3D3" "F3D5" "F3D6"
#> [17] "F3D7" "F3D8" "F3D9" "Mock"
sequences_names <- c(
"M00967_43_000000000-A3JHG_1_1103_5171_14027",
"M00967_43_000000000-A3JHG_1_1101_10133_8460"
)
df[df$sequence_name %in% sequences_names, c(1, 3, 4)]
#> sequence_name sample abundance
#> 1 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D2 222
#> 2 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D146 1
#> 3 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D149 1
#> 4 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D150 1
#> 5 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D1 127
#> 6 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D7 17
#> 7 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D0 32
#> 8 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D5 13
#> 9 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D8 95
#> 10 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D9 86
#> 11 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D3 5
#> 12 M00967_43_000000000-A3JHG_1_1101_10133_8460 F3D6 20
#> 1092 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D0 5
#> 1093 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D148 1
#> 1094 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D2 4
#> 1095 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D1 6
#> 1096 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D142 1
data_frame_results$set_abundance_values$sequence_name[1:2]
#> [1] "M00967_43_000000000-A3JHG_1_1101_10133_8460"
#> [2] "M00967_43_000000000-A3JHG_1_1101_10134_24617"
data_frame_results$set_abundance_values$abundance[1:2]
#> [[1]]
#> [1] 32 127 0 0 0 0 0 1 0 0 1 1 222 5 13 20 17 95 86
#> [20] 0
#>
#> [[2]]
#> [1] 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0We can see that the abundances for sequence M00967_43_000000000-A3JHG_1_1101_10133_8460 remain the same meaning it was not chimeric in any sample it was present in. We can see that sequence M00967_43_000000000-A3JHG_1_1101_10134_24617 was found to be chimeric in every sample it was included in.
Now let’s look at an example of a sequence that was found to be chimeric in some of the samples it is present in.
df[
df$sequence_name %in% "M00967_43_000000000-A3JHG_1_1103_5171_14027",
c(1, 3, 4)
]
#> sequence_name sample abundance
#> 1092 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D0 5
#> 1093 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D148 1
#> 1094 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D2 4
#> 1095 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D1 6
#> 1096 M00967_43_000000000-A3JHG_1_1103_5171_14027 F3D142 1
data_frame_results$set_abundance_values$samples
#> [1] "F3D0" "F3D1" "F3D141" "F3D142" "F3D143" "F3D144" "F3D145" "F3D146"
#> [9] "F3D147" "F3D148" "F3D149" "F3D150" "F3D2" "F3D3" "F3D5" "F3D6"
#> [17] "F3D7" "F3D8" "F3D9" "Mock"
data_frame_results$set_abundance_values$abundance[
data_frame_results$set_abundance_values$sequence_name %in%
"M00967_43_000000000-A3JHG_1_1103_5171_14027"
]
#> [[1]]
#> [1] 5 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0We can see that samples F3D0 and F3D142 did not find the sequence to be chimeric, but F3D1, F3D2, F3D148 did find it to be chimeric so the abundance for those samples is set to 0.