The hardware and bandwidth for this mirror is donated by dogado GmbH, the Webhosting and Full Service-Cloud Provider. Check out our Wordpress Tutorial.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]dogado.de.
Load the library.
library(refseqR)
This vignette shows a tutorial of how I have been using refseqR
to automate some common processes of my research. The package refseqR
is built on top of rentrez
, the excellent library written by David Winter to query the NCBI’s API and fetch the resulting data.
In short, refseqR
provides summary information at three different levels:
Given a gene symbol obtained from the ‘Gene’ database, the refseqR
library enables us to retrieve the associated mRNA and protein accessions.
<- c("LOC101512347")
gene_symbol <- refseq_fromGene(gene_symbol, sequence = "XM", retries = 3)
transcript <- refseq_fromGene(gene_symbol, sequence = "XP", retries = 3) protein
The mRNA transcript identifier (id) for LOC101512347 = XM_004487701.
The protein identifier (id) for LOC101512347 = XP_004487758.
Similarly, the function is effective when utilizing gene symbols that encode for multiple transcripts.
<- c("LOC105852298")
gene_symbol <- refseq_fromGene(gene_symbol, sequence = "XM", retries = 3)
transcript <- refseq_fromGene(gene_symbol, sequence = "XP", retries = 3) protein
The mRNA transcript id(s) for LOC105852298 = XM_027335934, XM_012717197.
The protein id(s) for LOC105852298 = XP_027191735, XP_012572651.
The function refseq_description
returns the sequence description corresponding to a given accession. The identifier (id) can be either a XM, XP, or Gene identifier
<- c("LOC101512347")
id refseq_description(id)
#> [1] "aldehyde dehydrogenase 22A1"
Using the rentrez
package, we can fetch data from NCBI. Here, the first 30 lines for accession “XM_004487701” :
<- rentrez::entrez_fetch(db= 'nuccore', id = "XM_004487701", rettype = 'gp')
mrna_gb strsplit(mrna_gb, "\n")[[1]][1:30]
#> [1] "LOCUS XM_004487701 2927 bp mRNA linear PLN 14-DEC-2018"
#> [2] "DEFINITION PREDICTED: Cicer arietinum aldehyde dehydrogenase 22A1"
#> [3] " (LOC101512347), mRNA."
#> [4] "ACCESSION XM_004487701"
#> [5] "VERSION XM_004487701.3"
#> [6] "DBLINK BioProject: PRJNA190909"
#> [7] "KEYWORDS RefSeq."
#> [8] "SOURCE Cicer arietinum (chickpea)"
#> [9] " ORGANISM Cicer arietinum"
#> [10] " Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;"
#> [11] " Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;"
#> [12] " Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50"
#> [13] " kb inversion clade; NPAAA clade; Hologalegina; IRL clade; Cicereae;"
#> [14] " Cicer."
#> [15] "COMMENT MODEL REFSEQ: This record is predicted by automated computational"
#> [16] " analysis. This record is derived from a genomic sequence"
#> [17] " (NC_021160.1) annotated using gene prediction method: Gnomon,"
#> [18] " supported by EST evidence."
#> [19] " Also see:"
#> [20] " Documentation of NCBI's Annotation Process"
#> [21] " "
#> [22] " On Dec 14, 2018 this sequence version replaced XM_004487701.2."
#> [23] " "
#> [24] " ##Genome-Annotation-Data-START##"
#> [25] " Annotation Provider :: NCBI"
#> [26] " Annotation Status :: Full annotation"
#> [27] " Annotation Name :: Cicer arietinum Annotation Release"
#> [28] " 102"
#> [29] " Annotation Version :: 102"
#> [30] " Annotation Pipeline :: NCBI eukaryotic genome annotation"
The refseq_fromXM
function serves as a wrapper built on top of ‘entrez_summary’ from the ‘rentrez’ package, designed to extract specific features from the obtained data. Typically, my focus lies on key features like id, accession, title, update, or sequence length (bp). However, you have the flexibility to tailor the function to extract additional features of interest from the esummary_list
object.
= c("XM_004487701", "XM_004488493", "XM_004501904")
xm = c("caption", "moltype", "sourcedb", "slen", "title")
feat refseq_fromXM(xm ,feat)
Another interesting function is refseq_XPfromXM
, which retrieves the protein accession associated with the provided mRNA.
<- "XM_004487701"
xm refseq_XPfromXM(xm)
#> [1] "XP_004487758"
The CDS coordinates come in handy when we want to get the fasta sequence. We sometimes do not want the 5’UTR or 3’UTR contained in the mRNA sequence and are interested just in the CDS.
The function refseq_CDScoords
creates an IRanges
object with the CDS coordinates from an mRNA accession. The output object is the basis for refseq_CDSseq
, which fetches the NCBI data, uses that coordinates and retuns a DNAString
object with the CDS nucleotide sequence.
refseq_CDScoords(xm)
#> IRanges object with 1 range and 0 metadata columns:
#> start end width
#> <integer> <integer> <integer>
#> XM_004487701.3 670 2457 1788
refseq_CDSseq(xm)
#> DNAStringSet object of length 1:
#> width seq names
#> [1] 1788 ATGGCGTTTTGGTGGTCTTTGCT...GTGGCAATAAGAAGGAGAAATGA XM_004487701.3
Here, the first 500 nucleotides of the mRNA ‘XM_004487701’:
= rentrez::entrez_fetch(db="nuccore", id=xm, rettype="fasta")
mrna_fasta # take a look at the first 500 chars.
cat(strwrap(substr(mrna_fasta, 1, 500)), sep="\n")
#> >XM_004487701.3 PREDICTED: Cicer arietinum aldehyde dehydrogenase 22A1
#> (LOC101512347), mRNA
#> GTTACCATGTCAACAAAAACTCTCAAGTCACTTTCTATTTGAAGCCGAGAAACCTATTATCTTTATGTCA
#> TGACAATTCCAAAATACATAACCCACATCTTTGCATGAATAGCATCACAATTCCCTAATTTTTTTATAAT
#> ACCCCTTAATCCATTTGTGGTCTACATATCGAAGTAAACCACTACACCCCCACTTTCTCTATAGATCTGT
#> GAGCTCGATCGCAATTTAGTTTGATTGTTACTTTATTTATTTATTAATCTCATTTTATATGTTTTCATTT
#> TCTTCTTGGAACCGATAAAGTCGTAGTTTATTCCTTTCTCAATTTGATGAAAAGTGCAAACTTGGAAAAG
#> AAAACAGGTTCACCTTTGAACTCAAATAAACAAGTACTACAATATCAAAACCC
Here, the first 60 nucleotides of the CDS from the mRNA ‘XM_004487701’:
substr(toString(refseq_CDSseq(xm)), 1, 60)
#> [1] "ATGGCGTTTTGGTGGTCTTTGCTCGTTCTAGCATTCGCTTTCGCTATCTGCAAGTTCCTT"
As previously said, the function refseq_description
returns the sequence description corresponding to a given accession. The identifier (id) can be either a XM, XP, or Gene identifier
<- "XM_004487701"
id refseq_description(id)
#> [1] "aldehyde dehydrogenase 22A1"
Similarly to nucleotide sequences, refseq_XMfromXP
, retrieves the mRNA associated with the provided protein accession.
<- "XP_020244413"
xp refseq_XMfromXP(xp)
#> [1] "XM_020388824"
Two specific functions prove useful for managing protein accessions: refseq_XPlength
offers the amino acid length of the sequence, while refseq_mol.wt
provides the molecular weight in Daltons.
refseq_XPlength(xp, retries = 3)
#> [1] 917
refseq_mol_wt(xp)
#> [1] 104178
The refseq_AAseq
function, fetches the NCBI data, and retuns a DNAString
object with the amino acid sequence.
refseq_AAseq(xp)
#> AAStringSet object of length 1:
#> width seq names
#> [1] 917 MSTRRVRKTKGKIPKKKISVEKL...SMGPDWHKVEHIPSLMIDPTTGE XP_020244413
As previously mentioned, the refseq_description
function ultimately provides the sequence description associated with a given accession. The identifier (id) can take the form of either an gene, XM, or XP identifier.
<- "XP_020244413"
id refseq_description(id)
#> [1] "probable disease resistance protein At1g58602"
The package refseqR
contains a number of functions to programmatically automatize some common operations.
Functions to apply on gene id. accessions
refseq_description
refseq_fromGene
Functions to apply on mRNA id. accessions
refseq_geneSymbol
refseq_CDScoords
refseq_CDSseq
refseq_XPfromXM
Functions to apply on protein id. accessions
refseq_geneSymbol
refseq_AAseq
refseq_mol_wt
refseq_XPlength
refseq_XMfromXP
I’d really appreciate your feedback. The whole code used in this tutorial is available from my Github repository. You can contact me by email or visit my website.
Córdoba, (Spain), 2024-05-15.
These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.
Health stats visible at Monitor.