The hardware and bandwidth for this mirror is donated by dogado GmbH, the Webhosting and Full Service-Cloud Provider. Check out our Wordpress Tutorial.
If you wish to report a bug, or if you are interested in having us mirror your free-software or open-source project, please feel free to contact us at mirror[@]dogado.de.
This R package contains tools to construct parser combinator
functions, higher order functions that parse input. The main goal of
this package is to simplify the creation of transparent parsers
for structured text files generated by machines like laboratory
instruments. Such files consist of lines of text organized in
higher-order structures like headers with metadata and blocks of
measured values. To read these data into R you first need to create a
parser that processes these files and creates R-objects as output. The
parcr package simplifies the task of creating such
parsers.
This package was inspired by the package “Ramble” by Chapman Siu and co-workers and by the paper “Higher-order functions for parsing” by Graham Hutton (1992).
Install the stable version from CRAN
install.packages("parcr")
To install the development version including its vignette run the following command
install_github("SystemsBioinformatics/parcr", build_vignettes=TRUE)
As an example of a realistic application we write a parser for fasta-formatted files for nucleotide and protein sequences. We use a few simplifying assumptions about this format for the sake of the example. Real fasta files are more complex than we pretend here.
Please note that more background about the functions that we use here is available in the package documentation. Here we only present a summary.
A fasta file with mixed sequence types could look like the example below:
>sequence_A
GGTAAGTCCTCTAGTACAAACACCCCCAAT
TCTGTTGCCAGAAAAAACACTTTTAGGCTA
>sequence_B
ATTGTGATATAATTAAAATTATATTCATAT
TATTAGAGCCATCTTCTTTGAAGCGTTGTC
TATGCATCGATC
>sequence_C
MTEITAAMVKELRESTGAGMMDCKNALSET
NGDFDKAVQLLREKGLGKAAKKADRLAAEG
ENEYKALVAELEKE
Since fasta files are text files we could read such a file using
readLines() into a character vector. The package provides
the data set fastafile which contains that character
vector.
data("fastafile")We can distinguish the following higher order components in a fasta file:
{G,A,T,C}.{A,R,N,D,B,C,E,Q,Z,G,H,I,L,K,M,F,P,S,T,W,Y,V}.It now becomes clear what we mean when we say that the package allows
us to write transparent parsers: the description above of the
structure of fasta files can be put straight into code for a
Fasta() parser:
Fasta <- function() {
one_or_more(SequenceBlock()) %then%
eof()
}
SequenceBlock <- function() {
MaybeEmpty() %then%
Header() %then%
(NuclSequence() %or% ProtSequence()) %using%
function(x) list(x)
}
NuclSequence <- function() {
one_or_more(NuclSequenceString()) %using%
function(x) list(type = "Nucl", sequence = paste(x, collapse=""))
}
ProtSequence <- function() {
one_or_more(ProtSequenceString()) %using%
function(x) list(type = "Prot", sequence = paste(x, collapse=""))
}Functions like one_or_more(), %then%,
%or%, %using%, eof() and
MaybeEmpty() are defined in the package and are the basic
parsers with which the package user can build complex parsers. The
%using% operator uses the function on its right-hand side
to modify parser output on its left hand side. Please see the vignette
in the parcr package for more explanation why this is
useful or necessary even.
Notice that the new parser functions that we define above are higher
order functions taking no input, hence the empty argument brackets
() behind their names.
Now we need to define the parsers Header(),
NuclSequenceString() and ProtSequenceString()
that actually recognize and process the header line string and strings
of nucleotide or protein sequences in the character vector
fastafile. We use the function constructor
stringparser() from the package to construct helper
functions that recognize and capture the desired matches, and we use
match_s() to to create parcr compliant parsers
from these.
Header <- function() {
match_s(stringparser("^>(\\w+)")) %using%
function(x) list(title = unlist(x))
}
NuclSequenceString <- function() {
match_s(stringparser("^([GATC]+)$"))
}
ProtSequenceString <- function() {
match_s(stringparser("^([ARNDBCEQZGHILKMFPSTWYV]+)$"))
}Now we have all the elements that we need to apply the
Fasta() parser.
Fasta()(fastafile)
#> $L
#> $L[[1]]
#> $L[[1]]$title
#> [1] "sequence_A"
#>
#> $L[[1]]$type
#> [1] "Nucl"
#>
#> $L[[1]]$sequence
#> [1] "GGTAAGTCCTCTAGTACAAACACCCCCAATTCTGTTGCCAGAAAAAACACTTTTAGGCTA"
#>
#>
#> $L[[2]]
#> $L[[2]]$title
#> [1] "sequence_B"
#>
#> $L[[2]]$type
#> [1] "Nucl"
#>
#> $L[[2]]$sequence
#> [1] "ATTGTGATATAATTAAAATTATATTCATATTATTAGAGCCATCTTCTTTGAAGCGTTGTCTATGCATCGATC"
#>
#>
#> $L[[3]]
#> $L[[3]]$title
#> [1] "sequence_C"
#>
#> $L[[3]]$type
#> [1] "Prot"
#>
#> $L[[3]]$sequence
#> [1] "MTEITAAMVKELRESTGAGMMDCKNALSETNGDFDKAVQLLREKGLGKAAKKADRLAAEGENEYKALVAELEKE"
#>
#>
#>
#> $R
#> list()The output of the parser consists of two elements, L and
R, where L contains the parsed and processed
part of the input and R the remaining un-parsed part of the
input. Since we explicitly demanded to parse until the end of the file
by the eof() function in the definition of the
Fasta() parser, the R element contains an
empty list to signal that the parser was indeed at the end of the input.
Please see the package documentation for more examples and
explanation.
Finally, let’s present the result of the parse more concisely using
the names of the elements inside the L element:
d <- Fasta()(fastafile)[["L"]]
invisible(lapply(d, function(x) {cat(x$type, x$title, x$sequence, "\n")}))
#> Nucl sequence_A GGTAAGTCCTCTAGTACAAACACCCCCAATTCTGTTGCCAGAAAAAACACTTTTAGGCTA
#> Nucl sequence_B ATTGTGATATAATTAAAATTATATTCATATTATTAGAGCCATCTTCTTTGAAGCGTTGTCTATGCATCGATC
#> Prot sequence_C MTEITAAMVKELRESTGAGMMDCKNALSETNGDFDKAVQLLREKGLGKAAKKADRLAAEGENEYKALVAELEKEBasic error messaging is implemented in the function
reporter(). You can wrap a parser in the
reporter() function to obtain an error message that reports
the line of the input in which the parser ultimately failed as well as
some lines around it to provide context. Suppose we have the following
badly formatted fasta file:
bad_header <- c(
"*sequence_A",
"GGTAAGTCCTCTAGTACAAACACCCCCAAT",
">sequence_B",
"ATTGTGATATAATTAAAATTATATTCATAT"
)Note that the first header starts with * instead of a
>. Upgrading the Fasta() parser with the
reporter() function to an error reporting parser
yields a basic error message:
reporter(Fasta())(bad_header)#> Error : Parser failed on line 1 of input.
#> 1 | >> *sequence_A
#> 2 | GGTAAGTCCTCTAGTACAAACACCCCCAAT
#> 3 | >sequence_B
#> 4 | ATTGTGATATAATTAAAATTATATTCATAT
We could, however, get better error messaging by upgrading the
Header() parser to a named parser:
Header <- function() {
named(
match_s(stringparser("^>(\\w+)")) %using%
function(x) list(title = unlist(x)),
"FASTA header (>sequence_name)"
)
}where the first argument to the named() function is a
parser body and the second argument is a brief description of the
parser. Now, the reporter yields a more detailed message:
reporter(Fasta())(bad_header)#> Error : Parser failed on line 1 of input.
#> Expected: FASTA header (>sequence_name)
#> 1 | >> *sequence_A
#> 2 | GGTAAGTCCTCTAGTACAAACACCCCCAAT
#> 3 | >sequence_B
#> 4 | ATTGTGATATAATTAAAATTATATTCATAT
Suppose we have the following bad fasta file:
missing_sequence <- c(
">sequence_A",
">sequence_B",
"ATTGTGATATAATTAAAATTATATTCATAT"
)Upgrading the NuclSequence and ProtSequence
to named parsers yields a better error message:
NuclSequence <- function() {
named(
one_or_more(NuclSequenceString()) %using%
function(x) list(type = "Nucl", sequence = paste(x, collapse="")),
"Nucleotide_Sequence"
)
}
ProtSequence <- function() {
named(
one_or_more(ProtSequenceString()) %using%
function(x) list(type = "Prot", sequence = paste(x, collapse="")),
"Protein_Sequence"
)
}reporter(Fasta())(missing_sequence)#> Error : Parser failed on line 2 of input.
#> Expected one of: Nucleotide_Sequence, Protein_Sequence
#> 1 | >sequence_A
#> 2 | >> >sequence_B
#> 3 | ATTGTGATATAATTAAAATTATATTCATAT
These binaries (installable software) and packages are in development.
They may not be fully stable and should be used with caution. We make no claims about them.
Health stats visible at Monitor.